MolecularSequence
A molecular sequence (DNA, RNA, AA) with coordinates, variants, reference citations. The raw material for FHIR genomics.
Purpose
MolecularSequence carries the raw sequential data: genome, exome, targeted fragment. It references a Patient, an originating GenomicStudy, and may carry detected variants. The resource is sized to point to external files (VCF/FASTA) rather than inline the terabytes of sequential data.
Key elements
| Field | Type | Cardinality | Role |
|---|---|---|---|
identifier | Identifier[] | 0..* | Sequence identifiers. |
type | code | 0..1 | `aa`, `dna`, `rna`. |
subject | Reference(Patient | Group | Substance | BiologicallyDerivedProduct | NutritionProduct) | 0..1 | Analysis subject. |
focus | Reference(Any)[] | 0..* | Analysis focus (gene, region). |
specimen | Reference(Specimen) | 0..1 | Source specimen. |
device | Reference(Device) | 0..1 | Sequencing platform. |
performer | Reference(Organization) | 0..1 | Performing lab. |
literal | string | 0..1 | Inline sequence (short). |
formatted | Attachment[] | 0..* | FASTA/VCF files. |
relative | BackboneElement[] | 0..* | Coordinates relative to a reference. |
JSON example
{
"resourceType": "MolecularSequence",
"id": "example-brca1-variant",
"type": "dna",
"subject": {
"reference": "Patient/oncology-12345"
},
"focus": [{
"reference": "Observation/brca1-region"
}],
"specimen": {
"reference": "Specimen/blood-sample-001"
},
"device": {
"reference": "Device/illumina-novaseq-6000"
},
"performer": {
"reference": "Organization/genomics-lab"
},
"literal": "ACTGCAGTCGATCGTACGATCG"
}Common pitfalls
- Trying to inline a full genome: the resource should point to external VCF/BAM.
- No Specimen: impossible to tie the sequence back to a physical specimen.
- Type=aa for a DNA sequence: confusion, impact on alignment tools.
Related resources
- genomicstudy — genomic study.
- specimen — specimen.
- observation — individual variants.
- diagnosticreport — report.